PPP1R15A as a therapeutic target to overcome chemoresistance in AML: An in vitro study

C Christina Sotiropoulou (1National and Kapodistrian University of Athens, Department of Biochemistry and Molecular Biology, Athens, Greece) C Christos Kontos A Anthi Bouchla (2University General Hospital Attikon, Second Department of Internal Medicine and Research Institute, Athens, Greece) T Theodora Chatziligeroudi (2University General Hospital Attikon, Second Department of Internal Medicine and Research Institute, Athens, Greece) S Sotiris Papageorgiou (2University General Hospital Attikon, Second Department of Internal Medicine and Research Institute, Athens, Greece) A Agni Vitsioti (2University General Hospital Attikon, Second Department of Internal Medicine and Research Institute, Athens, Greece) C Christina Apostolopoulou (2University General Hospital Attikon, Second Department of Internal Medicine and Research Institute, Athens, Greece) I Ioulia Markaki (2University General Hospital Attikon, Second Department of Internal Medicine and Research Institute, Athens, Greece) G Georgia Karamanou (2University General Hospital Attikon, Second Department of Internal Medicine and Research Institute, Athens, Greece) T Theodoros Karantanos V Vassiliki Pappa (2University General Hospital Attikon, Second Department of Internal Medicine and Research Institute, Athens, Greece)

Abstract

Abstract Introduction: Acute myeloid leukemia (AML) is often characterized by impaired DNA damage response (DDR), promoting chemoresistance and disease progression. The integrated stress response protein PPP1R15A (GADD34) regulates DDR and apoptosis under genotoxic stress. Our group has shown that PPP1R15A is upregulated in AML blasts and linked to chemotherapy resistance. This study aimed to elucidate downstream transcriptional networks controlled by PPP1R15A and evaluate its potential as a therapeutic target in AML. Methods: TF-1 AML cells were genetically modified to knock out PPP1R15A using lentiviral vectors (pLKO.1-puro, VectorBuilder) encoding Cas9 and sgRNAs targeting PPP1R15A (sgRNA1: AGGTCCTGGGAGTATCGTTC; sgRNA2: GGACAACACTCCCGGTGTGA), or a non-targeting control. Lentiviral particles were produced in HEK-293FT cells and used to transduce TF-1 cells, followed by puromycin selection (2 µg/mL). Single-cell clones were screened by qPCR to confirm PPP1R15A loss. Clonal cells were treated with idarubicin (10 nM) or cytarabine (100 nM) for 24 hours; untreated cells served as controls. Experimental groups included treated and untreated PPP1R15A-knockout and control TF-1 cells, each in triplicate. Total RNA was extracted, rRNA-depleted, and libraries were sequenced using the DNBSEQ-G400 platform (PE100). Reads were aligned to the GRCh38 genome using STAR, and DESeq2 was used for differential gene expression analysis. GO and KEGG pathway enrichment analyses were also performed. In parallel, MOLM-13 and KASUMI-1 AML cells were cultured in RPMI-1640 with 10–20% FBS. Cells were treated with PPP1R15A inhibitors, guanabenz (50 μM, 6 h), or sephin-1. Then guanabenz was selected for combination studies with idarubicin(IC₅₀: 10 nM, MOLM-13; 1 nM, KASUMI-1) or cytarabine (100 nM). Cell viability was measured using the MTT assay, and apoptosis was assessed via caspase-3 activity. Results: RNA-seq revealed extensive transcriptional reprogramming in PPP1R15A-knockout TF-1 cells treated with idarubicin or cytarabine. Compared to untreated knockout cells, both drugs triggered converging stress responses with significant changes in DNA repair, apoptosis, and mitochondrial genes. Idarubicin treatment increased RN7SL1, EEF1A1, and FTL, which are linked to translational and iron stress, while LAS1L, C1orf112, and NFYA, involved in ribosome biogenesis and replication, were decreased. Cytarabine-treated cells showed notable induction of DDIT4 and CD24 and suppression of MT-ND4, MT-CO3, and MT-CO2, indicating mitochondrial dysfunction and metabolic stress. Pathway analysis showed downregulation of p53 signaling, base excision repair, mismatch repair, and components of oxidative phosphorylation. Additionally, activation of the unfolded protein response (UPR) and ER stress-mediated apoptosis suggested collapse of proteostasis under treatment. Pharmacologic inhibition with guanabenz mimicked genetic PPP1R15A depletion. Only guanabenz instead of sephin-1 led to decreased levels of cytotoxicity. Guanabenz alone had minimal effects on viability or caspase-3 activity; its combination with chemotherapy significantly lowered survival and increased apoptosis. In MOLM-13, viability decreased to 61.7% (idarubicin+guanabenz) and 58.8% (cytarabine+guanabenz) compared to approximately 93–97% with monotherapies. KASUMI-1 cells displayed similar trends: 79.2% and 82.2% viability with combinations versus over 88% with individual drugs. Caspase-3 activity rose substantially in both cell lines when guanabenz was combined with idarubicin or cytarabine, supporting enhanced induction of apoptosis. Conclusions: Our findings identify PPP1R15A as a stress-adaptive regulator of chemoresistance in AML. Its depletion—either genetically or pharmacologically—rewires the DDR, disrupts mitochondrial and proteostasis networks, and amplifies apoptotic signaling upon chemotherapy. Targeting PPP1R15A sensitizes AML cells to genotoxic stress and represents a promising combinatorial strategy to overcome drug resistance and improve therapeutic efficacy.

Article Details

Journal Blood
Volume / Issue Vol. 146, Issue Supplement 1
Published November 03, 2025
Pages 6799-6799
ISSN 0006-4971
Publisher Elsevier BV

Journal Info

Blood

Elsevier BV

ISSN: 0006-4971 Health Sciences

Authors (11)

C

Christina Sotiropoulou

1National and Kapodistrian University of Athens, Department of Biochemistry and Molecular Biology, Athens, Greece

C

Christos Kontos

A

Anthi Bouchla

2University General Hospital Attikon, Second Department of Internal Medicine and Research Institute, Athens, Greece

T

Theodora Chatziligeroudi

2University General Hospital Attikon, Second Department of Internal Medicine and Research Institute, Athens, Greece

S

Sotiris Papageorgiou

2University General Hospital Attikon, Second Department of Internal Medicine and Research Institute, Athens, Greece

A

Agni Vitsioti

2University General Hospital Attikon, Second Department of Internal Medicine and Research Institute, Athens, Greece

C

Christina Apostolopoulou

2University General Hospital Attikon, Second Department of Internal Medicine and Research Institute, Athens, Greece

I

Ioulia Markaki

2University General Hospital Attikon, Second Department of Internal Medicine and Research Institute, Athens, Greece

G

Georgia Karamanou

2University General Hospital Attikon, Second Department of Internal Medicine and Research Institute, Athens, Greece

T

Theodoros Karantanos

V

Vassiliki Pappa

2University General Hospital Attikon, Second Department of Internal Medicine and Research Institute, Athens, Greece